I. The concept of "being" is central to philosophy. The concepts of “matter” and “consciousness” are closest to it.

The nature of understanding the essence of the existence of matter, consciousness is the main indicator of the philosopher's belonging to one or another philosophical school or direction.

The concept of "being" is equivalent to the terms "reality", "existing", "something". Although the extreme breadth of the concept of "being" makes it difficult to define it, nevertheless, some of its main features can be indicated:

"Being" is the broadest of philosophical concepts.

"Being" is the opposite of the concept of "non-being", which Democritus called "emptiness", and the religious philosophers of the Middle Ages - "nothing", from which God created the Earth. The philosophical categories of non-being and being are related to each other in the same way as mathematical concepts zero and an infinite natural series of numbers that starts with a simple one. In modern philosophy and natural sciences the category of nonexistence is described as vacuum or interstellar space. However, in modern science, non-existence is presented not as a void, but as a kind of other existence, a creative, active, generative, meaning-forming principle, or pra-matter.

Existence consists in the fact that, unlike structureless nonexistence, it has its own structure. Life is varied and varied. As its main forms, material, ideal, human can be distinguished in it, each of which is subdivided into many others. Non-existence or other existence - one, unstructured; being is many, many.

Being, unlike non-being, emptiness, vacuum is characterized by various properties. The most important of them are connections, relationships, dependencies, influences between separate parts and objects of being, including cause and effect. The properties of non-existence are much more limited: they, in fact, come down to the ability of non-existence to isolate from itself, to generate being, to create it.

Nevertheless, in spite of its diversity, being is one or, as it is now expressed, continual, reducible to a single basis, just as an infinite natural series of numbers is reduced to one. This property of being V.S. Solovyov expressed the category of unity.

However, in understanding the essence common ground life of philosophers different directions there were many differences.

How can you characterize various interpretations essence of being in the history of philosophical thought?

Initially, in the VII-VI centuries. BC e., ancient philosophers (Thales, Heraclitus) understood the material fundamental principle of the world as being. But then his understanding became very diverse. Therefore, it is reasonable to classify different approaches to the understanding of this complex philosophical category. Let's highlight the main ones first.

Philosophers-materialists believed that being is material. It can be air, water, fire, earth and other natural elements. So, according to Democritus, being are atoms: “Democritus considers the nature of the eternal to be small entities, infinite in number. He called them atoms, since they are solid and indivisible.

Philosophers-idealists, on the contrary, recognized being as ideal, believing that it is based on the idea, the universal mind, God, etc. In particular, Plato and his supporters “... called things ideas... they came to the conclusion that there is an idea of ​​everything... and everything sensually perceived exists apart from them and is named according to them, because through participation in eidos there is a whole multitude things of the same name with them" 2 . (Aristotle. Metaphysics. Works. In 4 volumes. T.1. - M., 1984. - P.328.)

Justifying their position on the essence of being, idealist philosophers specifically pointed out that although there is not a gram of material in the ideal, it nevertheless forms a special ideal world, an independent, real world. While the forms of material existence are finite, vague, transient, the ideal contains the possibility of immortality. These features of the spiritual, ideal superiority over the material also led to the emergence of teachings that denied not only the primacy of the material, but even any role of matter for man. This position was held by George Berkeley (1685-1753) and other subjective idealist philosophers.

Representatives of this philosophical school generally denied the existence of any objective - material or ideal - basis of the world. From their point of view, the basis of the world is subjective, i.e. is not outside the person, but in him, in his spiritual world.

So, according to Berkeley and Ernst Mach (1838-1916), who supported him, for a person, it is not abstract matter that really exists, but only separate things. But they are given to us only in consciousness, thinking as "complexes of sensations." They are the real reality for us. As for the category of matter, then, according to Berkeley, some philosophers need it only as "a reason for idle talk."

Modern Philosophy seeks to get rid of extremes in the interpretation of the concept of "being". In its modern understanding, various ideas are summed up, integrated, as it were.

When, after a thousand years, the Greeks began to use the mosaic alphabet (with mirrored signs, Fig. 55), they found that several letters had to be added to make it easier to pronounce. Indeed, in the semitic mosaic alphabet of twenty-two letters, some letters could be pronounced as soft or hard, and doubling of letters was used to designate vowels.

Thinking about this limitation of twenty-two letters - no more and no less - we involuntarily turn to the restrictions associated with the sacred number "twelve" (for example, it was required to maintain an unchanged number of gods of the Olympic Circle). Perhaps the same secret principle established by the gods applies to the original alphabet of twenty-two letters?

The number "twenty-two" is widely known in modern world. This is the number of chromosomes that a person had before the second genetic manipulation, when the sex X and Y chromosomes were added!

Could Almighty God. who initiated Moses into the secret of the alphabet, to use to create it genetic code?

Apparently, it was.

If this conclusion seems incredible to you, let us turn to the words of the prophet Isaiah (45:11) that the Lord created "letters" and also "created the earth and created man on it." That is, the creator of man also came up with the letters that make up the alphabet.

Modern computers use a binary system of "zeros" and "ones" to represent words and numbers (corresponding to turning on or off the flow of electrons).

However, the attention of scientists recent times attracts a four-letter genetic code and a much faster transfer of information in living cells. Theoretically modern computer language, which uses sequences like 0100110011110011000010100 etc. (with an infinite number combinations of "1" and "0") can be considered as an analogue of the DNA genetic code, which is a sequence of nucleotides, for example CGTAGAATTCTGCGAACCTT, always combined into three-syllable "words" and having pair bonds when A is connected to T, and C to G. Difficulty is to create computers that would operate not with electronic "1" and "0", but with units of genetic material. Latest achievements science - including genetics - made it possible to create silicone chips in a shell of nucleotides. Comparison of the speed and capabilities of "DNA computers" (this name was given to new area studies) with conventional ones, led to the conclusion "about the enormous information capacity of DNA" (article in the journal "Science", October 1997).

Naturally encoded in DNA genetic information is deciphered with incredible speed by a messenger called RNA, which recognizes the "letters" of DNA and recombines them into three-syllable "words". It turned out that it is these groups of three letters that make up the biological and chemical basis of all forms of life on Earth, since it is they who “record” twenty amino acids, the chains of which form all the protein compounds of our planet - a. possibly the entire universe. On fig. 56 schematically illustrates in simplified form how a strand of DNA is decoded and recombined into the amino acids proline (Pro), serie (Ser), etc. - to build a protein using a three-letter "word" code.

The structure of the rich and precise Hebrew language is based on "root" words, from which verbs, nouns, adverbs, adjectives, pronouns, as well as various times, declensions and others grammatical forms. For unknown reasons, all of these root words consist of three letters. Here we see a difference from the Akkadian language, the progenitor of all languages ​​​​of the Semitic group, in which words were formed from syllables - sometimes one, sometimes two, three or more.

Could the three-letter root words of the Hebrew language come from the three-letter language of DNA, which, as we found out, served as the prototype of the alphabet itself? Three-letter root words may support this hypothesis.

“Death and life are in the power of the tongue,” says the Bible in the Book of Proverbs of Solomon (18:21). These words have always been perceived as an allegory. Maybe it's time to take them literally: language Hebrew Bible and the genetic code of life imprinted in DNA are two sides of the same coin.

The secrets encoded in them are much deeper than we can imagine, and among them, among others, amazing discoveries, there are secrets of healing.

CHAPTER EIGHT

%0A Warning:%20Missing%20argument%201%20for%20wp_get_attachment_image_src(),%20called%20in%20/home/users/j/jin621/domains/site/wp-content/themes/ab-inspiration/single.php%20on%20line %2040%20and%20defined%20in%20 /home/users/j/jin621/domains/website/wp-includes/media.php%20on%20line%20 751
%0A">

Flowers, herbs, fruits, trees - they all smell familiar and pleasant. And often it is just the component that forms our favorite scent.

But you probably know that along with floral, fruity and woody raw materials, ingredients of animal origin are used in perfumery. Perhaps yours just contains such an ingredient.

A well-known musk- sensual and languid, aphrodisiac smell extracted from the gonads of the male musk deer. This is very a pretty kind of deer, however, his fangs are quite frightening. Dwells in mountainous areas China, Tibet, is also found in Russian open spaces: from the lower Altai to the Amur River. Today, the musk deer is listed in the Red Book, and not only because it was actively exterminated for perfume production. Highly wide application deer secret found in Chinese medicine. Musk is used in many Chinese medicines and because of this, hunting for musk deer is intensifying.

Often used in eastern group perfume is nothing more than a waste product of the sperm whale, or rather, a wax-like substance formed in its digestive tract. It is still not known exactly why this substance is formed inside the body of the sperm whale. There is a version that ambergris formed as a result of various wounds that occur when swallowed by sperm whales spicy food, but scientists do not yet have 100% confidence in this. They find ambergris inside sperm whales, and on the coast of the oceans where they live.

If your favorite scent belongs to the amber group, then you will be interested to know that ambergris is fresh, white, plain and black. The most expensive and rare is white amber, it is she who exudes a delicate sweetish aroma. Fresh and black ambergris have not lain in water for a long time, have not acquired the desired shade of smell, and therefore are not suitable for perfumery products. But the usual, along with white, is used. It, unlike white amber, can be purchased in the respective markets, while the right to purchase white amber has long and firmly settled with manufacturers of elite perfumes.

Ambergris, like musk, is actively used in alternative medicine. Today, a synthetic ambergris substitute is often used to produce a favorite scent. And, probably, this saved many sperm whales from hunting them.

Less known and not so often used is another element of animal origin - civet. This is the secret of a wild African cat, or rather a civet from the Viver family. In nature, there are 6 types of civet, African - the largest. Outwardly, the civet resembles a marten (muzzle) and a cat (trunk), which is why it is also called a weaver cat. In addition to Africa, the animal can also be found in India.

Actually civet nowadays it is imported mainly from Indonesia. And in old days, as the books testify, Dutch merchants kept several animals right in Amsterdam in special cages and collected secretions with a spatula 2-3 times a week for further use in perfumery.

They say that the smell of civet itself is very unpleasant, but perfume masters exist to know in what concentration to take this substance and with what to mix it so that an unforgettable delicate, floral, beloved aroma appears.

Maybe if your belongs to the flower-fruit group, then its constituent is civet.

As you can see, the saddest fate befell the musk deer, this species is almost on the verge of extinction. Perhaps, over time, the natural components of the perfume of animal origin will be completely replaced by synthetic ones. Or, by at least, will find more humane way obtaining them so that the favorite aroma that gives us so much pleasure is not the cause of someone's extermination.

Fear is one of natural parts emotional life any person. It often happens that fear reaches a point where it becomes very difficult to get rid of it.

Despite the fact that a considerable amount of research has already been carried out on the topic of fear, it still has many mysteries that modern science doesn't know the answer. That is why a group of scientists from Freiburg, led by Ioannis Vlachs, decided to use computer simulation to better understand the processes that occur in the human brain during the formation and disappearance of fears. For the first time in history, these scientists managed to explain that all the fears that we think have already passed actually continue to exist, but in a hidden form.

It turned out that fears in literally take root very deeply: much lower than the cerebral cortex is associated with the so-called "almond-shaped body", which plays one of the decisive roles in the processes of fear.

Usually, fear is studied in laboratory mice by exposing them to both a neutral stimulus - certain sound, and the stimulus that delivers discomfort. This all leads to the fact that animals are simply afraid of sound.

At the same time, the context plays a very important role: In the event that a frightening sound was played many times in a new context without any bad actions, the animals got rid of fear. The fear immediately returned if the sound was played in the original or even completely in a new context. That is, it turns out that mice have not forgotten how to be scared?

The fact that the fears of men, women and children are able to "mask" has already been known for a long time. But only recently scientists have shown that two groups nerve cells, which are in the middle of the amygdala, take part in this process.

Thanks to the fact that scientists used computer simulations of the neuron network of the amygdala, they were able to explain how fear masking occurs in the human brain: one group of cells is responsible for the fear response, and the second is involved in the process of its suppression. The functioning of the second group inhibits the actions of the first and, thus, prevents the transfer of fears to other areas of the brain. However, there is a change in their connections, and these connections can come into effect again, for example, from a change in context. As a result, the feeling of fear may return.

Scientists hope that the results of the study will help in the near future to more successfully treat various fears.

Good day, Dear friends. Today, there are practically no people who would not know about cryptocurrencies. But it is not even the digital assets themselves that are of particular importance, but the technology that they popularize - this is the blockchain.

Blockchain itself is the epitome of decentralization and a possible financial revolution that is already approaching. Without a doubt, this technology has a very serious potential, and in the future it will certainly show itself from the best side.

Yes, so far everything is happening at the test level, but let's make allowances for the fact that blockchain is a very young technology. The principle of decentralization, which is embedded in it, can change not only the financial sector but all of our lives in general.

In 2017, there was a lot of talk about the blockchain and the principle of decentralization, but in 2018 they have become much less. The cost of many cryptocurrencies continued to actively decline, and the voices of many adherents digital assets gradually began to subside. Given such a large-scale information lull, one might think that the technology itself has lost its former glory.

The picture was aggravated by the fact that the governments of many countries spoke out extremely negatively against cryptocurrencies, and various forums were full of topics that cryptocurrencies are a universal evil and a fraud on a large scale. The opinion began to spread that against the backdrop of all this chaos reigning in this area, blockchain technology began to lose relevance. If you share this opinion, then you are probably extremely far from the truth.

Now we will try to figure it out with you and find confirmation that the principle of decentralization is alive and continues to improve. We will not go into philosophical conjectures and reasoning, but simply resort to consideration of dry facts. And as you know, you can't argue against the facts.

MACHINES WILL BE SMART

From the very beginnings of the global industrial revolution, people have been creating machines, further fully controlling their work. Over time, machines have become full partners for humans, helping them solve a bunch of problems. important issues. Now there are many things in which machines are superior to us. Elementary, in order to calculate something, we resort to the help of a calculator. If something needs to be translated, we turn to online translators. And there are many such examples. The fact remains that machines have become indispensable companions in human activities, making it easier for him to solve certain problems.

However, technology artificial intelligence, which so excite our consciousness, today can be considered only the tip of the iceberg. Now there are many organizations that themselves develop platforms that operate on the basis of artificial intelligence. But the real breakthrough will come when organizations start teaming up and creating AI-powered platforms that will be more technologically advanced when grouped together. It will become a global and perfect mechanism that will change our lives forever.

Let's look absolutely real examples. Now in many big banks There are already platforms built on the basis of AI, and they help to identify the likelihood of fraud in certain payments. Each bank develops own model based on their statistics. Such banks are able to fight back fraudsters more quickly and efficiently, and this is their main competitive advantage.

VIDEO

But despite this, fraudulent activities with various payments remain a problem of the modern financial model. But, let's be frank, any bank first of all seeks to lobby own goals. The benefit for the bank is much more important than the benefit it can bring to society.

Now it is very unlikely that banks around the world will create their own conglomerate, within which a single perfect AI model that prevents fraud will be derived. Banks, one way or another, compete with each other, and it is unlikely that they will form an alliance in the foreseeable future. If this does not happen, then the problems of fraud will remain open.

It is very interesting that within the framework of such a trend, the principle of decentralization will allow all financial structures not only to maintain their economic value, but also to bring significant benefits to society. How can it work? Theoretically, banks can create a single AI model that will be stored on the blockchain.

Any participant can easily get the latest copy of the model from the blockchain, train it according to their own principles, and put it back into the blockchain, confirming the fact that the training has passed.

If the network recognizes that training has had a positive impact on the performance of the model, then this will automatically spread to other participants, which will allow maintaining high efficiency system and its continuous modernization.

As a reward, a participant who has successfully trained the system can receive additional rewards in the form of tokens that will be generally accepted within the network. Thus, the model will be constantly improved, and each individual participant will be able to maintain the economic value of their own data, thereby acting for the benefit of both themselves and society as a whole.

MACHINES WILL START TALKING

As shining example you can bring cars with unmanned control here, which is already becoming a kind of trend. If machines are self-governing, then they need a way in which they can communicate.

Direct and established communication simply cannot be provided through centralized systems. The fact is that if at least one element of the centralized network fails, then the entire system may collapse. If we talk specifically about cars, then such problems can provoke numerous accidents. If machines can communicate with each other, then dependence on centralized networks can have a number of specific dangers.

With the advent of self-driving cars, there will also be new economic models of particular interest.

For example, on what basis will the car decide that it is necessary to give way to another vehicle?

I think it would be logical if the cars can negotiate with each other, based on the preferences of the passenger being transported. For example, if a passenger is in a hurry, then he can pay a certain amount to other road users so that you let him through.

Accordingly, those participants in the movement who are not particularly in a hurry let others pass and receive their reward. Perhaps, over time, within the framework of this issue, two options will become relevant, according to which the passenger will initially decide how to go:

• get to necessary point faster by paying rewards to other road users.
• Get to the point more slowly, skipping those who are in a hurry, but getting a reward in the process.

Such communication must take place directly between vehicles. At the same time, it must function without interruption in 24/7 mode, which can only be provided by a decentralized network.

HOW NOT TO MISS AN OPPORTUNITY

First of all, it is now necessary to strive for new knowledge, while others remain in the dark. The principle of decentralization is perfectly applicable not only on the stock exchange, but also in many areas of our activity. It is not known what the fate of cryptocurrencies is in the future, but the principles that the blockchain imposes are really valuable and can change our lives beyond recognition in the future.